Hair loss abstract
Indolecarboxylic acid compounds and derivatives thereof, notably
4,6-dimethoxyindole-2-carboxylic acid and derivatives thereof, are
especially useful for inducing/stimulating mammalian hair growth
and/or preventing/retarding mammalian hair loss.
Hair loss claims
What is claimed is:
1. A method for inducing or stimulating mammalian hair growth and/or
retarding mammalian hair loss on a mammalian subject in need of
such treatment, comprising topically applying onto the hair and/or
scalp of said mammalian subject, a hair growth inducing or stimulating
and/or hair loss retarding effective amount of at least one indolecarboxylic
acid compound, or ester or salt thereof, said at least one indolecarboxylic
acid compound having the structural formula (I): ##STR4## in which
R.sub.1 and R.sub.2, which may be identical or different, are each
a hydrogen atom; a C.sub.1 -C.sub.6 alkyl radical, optionally substituted
with an --OH, --NHR.sub.3, --SH, --COOH or --COOR.sub.3 radical,
wherein R.sub.3 is a linear or branched C.sub.1 -C.sub.4 alkyl radical;
a C.sub.7 -C.sub.12 aralkyl radical; or a radical --CHR.sub.4 R.sub.5
wherein R.sub.4 and R.sub.5, which may be identical or different,
are each a hydrogen atom, an optionally substituted phenyl radical,
or a 5- or 6-membered heterocycle; or an acylated derivative or
physiologically acceptable salt thereof.
2. The method as defined by claim 1, wherein R.sub.1 in formula
(I) is a hydrogen atom or a methyl or ethyl radical.
3. The method as defined by claim 2, wherein R.sub.1 in formula
(I) is a hydrogen atom.
4. The method as defined by claim 1, wherein R.sub.1 in formula
(I) is a hydrogen atom or a methyl radical.
5. The method as defined by claim 4, wherein R.sub.1 in formula
(I) is a hydrogen atom.
6. The method as defined by claims 2, wherein R.sub.2 in formula
(I) is a hydrogen atom or a methyl radical.
7. The method as defined by claim 1, said at least one indolecarboxylic
acid compound of formula (I), or derivative thereof, being selected
from 4,6-dimethoxyindole-2-carboxylic acid, methyl 4,6-dimethoxyindole-2-carboxylate,
N-methyl-4,6-dimethoxyindole-2-carboxylic acid, methyl N-methyl-4,6-dimethoxyindole-2-carboxylate
or N-ethyl-4,6-dimethoxyindole-2-carboxylic acid.
8. The method as defined by claim 7, wherein said at least one
indolecarboxylic acid compound of formula (I), or derivative thereof,
is 4,6-dimethoxyindole-2-carboxylic acid or a mixture of 4,6-dimethoxyindole-2-carboxylic
acid and at least one compound selected from methyl 4,6-dimethoxyindole-2-carboxylate,
N-methyl-4,6-dimethoxyindole-2-carboxylic acid, methyl N-methyl-4,6-dimethoxyindole-2-carboxylate
or N-ethyl-4,6-dimethoxyindole-2-carboxylic acid.
9. A topically applicable cosmetic or dermatological composition
for inducing or stimulating mammalian hair growth and/or retarding
mammalian hair loss, comprising a cosmetically or therapeutically
effective amount of at least one indolecarboxylic acid compound
or ester or salt thereof, said at least one indolecarboxylic acid
compound having the structural formula (I): ##STR5##
in which R.sub.1 and R.sub.2, which may be identical or different,
are each a hydrogen atom; a C.sub.1 -C.sub.6 alkyl radical, optionally
substituted with an --OH, --NHR.sub.3, --SH, --COOH or --COOR.sub.3
radical, wherein R.sub.3 is a linear or branched C.sub.1 -C.sub.4
alkyl radical; a C.sub.7 -C.sub.12 aralkyl radical; or a radical
--CHR.sub.4 R.sub.5 wherein R.sub.4 and R.sub.5, which may be identical
or different, are each a hydrogen atom, an optionally substituted
phenyl radical, or a 5- or 6-membered heterocycle; or an acylated
derivative or physiologically acceptable salt thereof; and a physiologically
acceptable medium; wherein said physiologically acceptable medium
is anhydrous or aqueous, and said anhydrous medium is a solvent
selected from among C.sub.2 -C.sub.4 lower alcohols, alkylene glycol
alkyl ethers or dialkylene glycol alkyl ethers, the alkyl or alkylene
radicals of which have from 1 to 6 carbon atoms; and said at least
one indolecarboxylic acid compound or ester or salt thereof is formulated
into a topically acceptable, cosmetically or dermatologically acceptable
vehicle, diluent or carrier therefor.
10. The cosmetic or dermatological composition as defined by claim
9, comprising from 0.3% to 30% by weight of said at least one compound
having the structural formula (I).
11. The cosmetic or dermatological composition as defined by claim
10, comprising from 0.5% to 20% by weight of said at least one compound
having the structural formula (I).
12. The cosmetic or dermatological composition as defined by claim
9, further comprising an aqueous or anhydrous medium, milk, ointment,
emulsion, gel, cream, liposomal form, shampoo or aerosol.
13. The cosmetic or dermatological composition as defined by claim
9, further comprising at least one nicotinic acid ester, 2,4-diamino-6-piperidinopyrimidine
3-oxide, agent for promoting hair regrowth other than said at least
one indolecarboxylic compound, antibacterial agent, calcium antagonist,
hormone, anti-inflammatory agent, anti-androgenic agent, 5.alpha.-reductase
inhibitor, potassium agonist, dioxide, spiroxazone, phospholipid,
salicyclic acid or an alkyl derivative thereof bearing an alkyl
radical of from 2 to 12 carbon atoms in position 5 of the benzene
ring, hydroxycarboxylic or ketocarboxylic acid or ester thereof,
lactone or salt thereof, anthralin, carotenoid, eicosatetraenoic
or eicosatrienoic aid or ester or amide thereof, vitamin D, or extract
of plant or bacterial origin.
14. The method as defined by claim 1, wherein formula (I), R.sub.1
is a C.sub.1 -C.sub.6 alkyl radical, optionally substituted with
an --OH, --NHR.sub.3, --SH, --COOH or --COOR.sub.3 radical, wherein
R.sub.3 is a linear or branched C.sub.1 -C.sub.4 alkyl radical;
a C.sub.7 -C.sub.12 aralkyl radical; or a radical --CHR.sub.4 R.sub.5
wherein R.sub.4 and R.sub.5, which may be identical or different,
are each a hydrogen atom, an optionally substituted phenyl radical,
or a 5- or 6-membered heterocycle; and R.sub.2 is a hydrogen atom,
a C.sub.1 -C.sub.6 alkyl radical, optionally substituted with an
--OH, --NHR.sub.3, --SH, --COOH or --COOR.sub.3 radical, wherein
R.sub.3 is a linear or branched C.sub.1 -C.sub.4 alkyl radical;
a C.sub.7 -C.sub.12 aralkyl radical; or a radical--CHR.sub.4 R.sub.5
wherein R.sub.4 and R.sub.5, which may be identical or different,
are each a hydrogen atom, an optionally substituted phenyl radical,
or a 5- or 6-membered heterocycle.
15. The method as defined by claim 1, wherein formula (I), R.sub.1
is a C.sub.1 -C.sub.6 alkyl radical, optionally substituted with
an --OH, --NHR.sub.3, --SH, --COOH or --COOR.sub.3 radical, wherein
R.sub.3 is a linear or branched C.sub.1 -C.sub.4 alkyl radical;
a C.sub.7 -C.sub.12 aralkyl radical; or a radical --CHR.sub.4 R.sub.5
wherein R.sub.4 and R.sub.5, which may be identical or different,
are each a hydrogen atom, an optionally substituted phenyl radical,
or a 5- or 6-membered heterocycle; and R.sub.2 is a hydrogen atom
or a methyl radical.
16. The method as defined by claim 1, wherein formula (I), R.sub.1
is a hydrogen atom, a C.sub.1 -C.sub.6 alkyl radical, optionally
substituted with an --OH, --NHR.sub.3, --SH, --COOH or --COOR.sub.3
radical, wherein R.sub.3 is a linear or branched C.sub.1 -C.sub.4
alkyl radical; a C.sub.7 -C.sub.12 aralkyl radical; or a radical
--CHR.sub.4 R.sub.5 wherein R.sub.4 and R.sub.5, which may be identical
or different, are each a hydrogen atom, an optionally substituted
phenyl radical, or a 5- or 6-membered heterocycle; and R.sub.2 is
a C.sub.2 -C.sub.6 alkyl radical, optionally substituted with an
--OH, --NHR.sub.3, --SH, --COOH or --COOR.sub.3 radical, wherein
R.sub.3 is a linear or branched C.sub.1 -C.sub.4 alkyl radical;
a C.sub.7 -C.sub.12 aralkyl radical; or a radical --CHR.sub.4 R.sub.5
wherein R.sub.4 and R.sub.5, which may be identical or different,
are each a hydrogen atom, an optionally substituted phenyl radical,
or a 5- or 6-membered heterocycle.
17. The method as defined by claim 1, wherein formula (I), R.sub.1
is a hydrogen atom and R.sub.2 is a C.sub.2 -C.sub.6 alkyl radical,
optionally substituted with an --OH, --NHR.sub.3, --SH, --COOH or
--COOR.sub.3 radical, wherein R.sub.3 is a linear or branched C.sub.1
-C.sub.4 alkyl radical; a C.sub.7 -C.sub.12 aralkyl radical; or
a radical --CHR.sub.4 R.sub.5 wherein R.sub.4 and R.sub.5, which
may be identical or different, are each a hydrogen atom, an optionally
substituted phenyl radical, or a 5- or 6-membered heterocycle.
18. The cosmetic or dermatological composition as defined by claim
9, wherein formula (I), R.sub.1 is a C.sub.1 -C.sub.6 alkyl radical,
optionally substituted with an --OH, --NHR.sub.3, --SH, --COOH or
--COOR.sub.3 radical, wherein R.sub.3 is a linear or branched C.sub.1
-C.sub.4 alkyl radical; a C.sub.7 -C.sub.12 aralkyl radical; or
a radical --CHR.sub.4 R.sub.5 wherein R.sub.4 and R.sub.5, which
may be identical or different, are each a hydrogen atom, an optionally
substituted phenyl radical, or a 5- or 6-membered heterocycle; and
R.sub.2 is a hydrogen atom, a C.sub.1 -C.sub.6 alkyl radical, optionally
substituted with an --OH, --NHR.sub.3, --SH, --COOH or --COOR.sub.3
radical, wherein R.sub.3 is a linear or branched C.sub.1 -C.sub.4
alkyl radical; a C.sub.7 -C.sub.12 aralkyl radical; or a radical
--CHR.sub.4 R.sub.5 wherein R.sub.4 and R.sub.5, which may be identical
or different, are each a hydrogen atom, an optionally substituted
phenyl radical, or a 5- or 6-membered heterocycle.
19. The cosmetic or dermatological composition as defined by claim
9, wherein formula (I), R.sub.1 is a C.sub.1 -C.sub.6 alkyl radical,
optionally substituted with an --OH, --NHR.sub.3, --SH, --COOH or
--COOR.sub.3 radical, wherein R.sub.3 is a linear or branched C.sub.1
-C.sub.4 alkyl radical; a C.sub.7 -C.sub.12 aralkyl radical; or
a radical --CHR.sub.4 R.sub.5 wherein R.sub.4 and R.sub.5, which
may be identical or different, are each a hydrogen atom, an optionally
substituted phenyl radical, or a 5- or 6-membered heterocycle; and
R.sub.2 is a hydrogen atom or a methyl radical.
20. The cosmetic or dermatological composition as defined by claim
9, wherein formula (I), R.sub.1 is a hydrogen atom, a C.sub.1 -C.sub.6
alkyl radical, optionally substituted with an --OH, --NHR.sub.3,
--SH, --COOH or --COOR.sub.3 radical, wherein R.sub.3 is a linear
or branched C.sub.1 -C.sub.4 alkyl radical; a C.sub.7 -C.sub.12
aralkyl radical; or a radical --CHR.sub.4 R.sub.5 wherein R.sub.4
and R.sub.5, which may be identical or different, are each a hydrogen
atom, an optionally substituted phenyl radical, or a 5- or 6-membered
heterocycle; and R.sub.2 is a C.sub.2 -C.sub.6 alkyl radical, optionally
substituted with an --OH, --NHR.sub.3, --SH, --COOH or --COOR.sub.3
radical, wherein R.sub.3 is a linear or branched C.sub.1 -C.sub.4
alkyl radical; a C.sub.7 -C.sub.12 aralkyl radical; or a radical
--CHR.sub.4 R.sub.5 wherein R.sub.4 and R.sub.5, which may be identical
or different, are each a hydrogen atom, an optionally substituted
phenyl radical, or a 5- or 6-membered heterocycle.
21. The cosmetic or dermatological composition as defined by claim
9, wherein formula (I), R.sub.1 is a hydrogen, a C-C.sub.6 alkyl
radical, optionally substituted with an --OH, --NHR.sub.3, --SH,
--COOH or --COOR.sub.3 radical, wherein R.sub.3 is a linear or branched
C.sub.1 -C.sub.4 alkyl radical; a C.sub.7 -C.sub.12 aralkyl radical;
or a radical --CHR.sub.4 R.sub.5 wherein R.sub.4 and R.sub.5, which
may be identical or different, are each a hydrogen atom, an optionally
substituted phenyl radical, or a 5- or 6-membered heterocycle; and
R.sub.2 is a C.sub.2 -C.sub.6 alkyl radical, optionally substituted
with an --OH, --NHR.sub.3, --SH, --COOH or --COOR.sub.3 radical,
wherein R.sub.3 is a linear or branched C.sub.1 -C.sub.4 alkyl radical;
a C.sub.7 -C.sub.12 aralkyl radical; or a radical --CHR.sub.4 R.sub.5
wherein R.sub.4 and R.sub.5, which may be identical or different,
are each a hydrogen atom, an optionally substituted phenyl radical,
or a 5- or 6-membered heterocycle.
Hair loss description
BACKGROUND OF THE INVENTION
1. Technical Field of the Invention
The present invention relates to the administration of an effective
amount of 4,6-dimethoxyindole-2-carboxylic acid or derivative or
composition comprised thereof, to induce and/or stimulate hair growth
and/or to prevent hair loss.
2. Description of the Prior Art
In human subjects, the growth and renewal of the hair are principally
determined by the activity of the hair follicles. This activity
is cyclic and essentially comprises three phases, i.e., the anagenic
phase, the catagenic phase and the telogenic phase.
The active anagenic phase, or growth phase, which lasts for several
years and during which the hair becomes longer, is followed by a
very short and transient catagenic phase which lasts a few weeks,
and then a rest or quiescent phase, known as the telogenic phase,
which lasts a few months.
At the end of the rest period, the hair falls out and another cycle
begins. The head of hair is thus under constant renewal, and out
of the approximately 150,000 hairs on a human head of hair, at any
given moment, approximately 10% of them are at rest and will thus
be replaced within a few months.
However, different causes can lead to a considerable, temporary
or permanent, loss of hair. Alopecia is essentially due to a disruption
in hair renewal which gives rise, in a first stage, to an acceleration
of the frequency of the cycles, at the expense of the quality of
the hair and then at the expense of its quantity. A gradual depletion
of the head of hair takes place by regression of the so-called "terminal"
hairs at the downy stage. Regions are preferentially affected, in
particular the temples or frontal bulbs in men, and in women diffuse
alopecia of the vertex is observed.
The term "alopecia" is generic to the entire family of
afflictions of the hair follicle, the final consequence of which
is the partial or general permanent loss of the hair. In a large
number of cases, early loss of the hair occurs in genetically predisposed
individuals and especially is prevalent in men. This ie more particularly
the case as regards androgenetic or androgenic or even androgeno-genetic
alopecia.
Active agents for suppressing or reducing alopecia, and in particular
for inducing or stimulating hair growth or reducing hair loss, have
long been considered desiderata in the cosmetics and pharmaceutical
industries.
In this respect, a large number of very diverse active compounds
have already been proposed for such purposes, for example, 2,4-diamino-6-piperidino-pyrimidine
3-oxide or "Minoxidil" as described in U.S. Pat. Nos.
4,139,619 and 4,596,812, or the many derivatives thereof, such as
those described, for example, in EP-0,353,123, EP-0,356,271, EP-0,408,442,
EP-0,522,964, EP-0,420,707, EP-0,459,890 and EP-0,519,819.
Specific compounds of the indolecarboxylic family, such as those
described in WO-A-99/12905, have also been proposed for their ability
to induce and/or stimulate hair growth and/or to prevent hair loss.
These compounds exhibit pronounced inhibitory activity on type
I and type II 5.alpha.-reductases, which, according to the theory
which considers that these proteins are involved in hair loss, makes
them excellent candidates as active principles for inducing and/or
stimulating hair growth and/or for preventing hair loss.
However, 5.alpha.-reductases are not exclusively present in the
hair follicles, and the value of providing compounds suited for
inducing and/or stimulating hair growth and/or of preventing hair
loss, but which have no activity on type I and II 5.alpha.-reductases,
consequently, can readily be appreciated.
SUMMARY OF THE INVENTION
It has now surprisingly and unexpectedly been determined that 4,6-dimethoxyindole-2-carboxylic
acid and derivatives thereof have the property of inducing and/or
stimulating hair growth and/or of preventing hair loss, but do not
exhibit any activity on type I and type II 5.alpha.-reductases.
Briefly, the present invention features cosmetic/dermatological
compositions comprising a therapeutically effective amount of at
least one compound having the structural formula (I): ##STR1##
in which R.sub.1 and R.sub.2, which may be identical or different,
are each a hydrogen atom; a C.sub.1 -C.sub.6 alkyl radical, optionally
substituted with an --OH, --NHR.sub.3, --SH, --COOH or --COOR.sub.3
radical, in which R.sub.3 is a linear or branched C.sub.1 -C.sub.4
alkyl radical; a C.sub.7 -C.sub.12 aralkyl radical; or a radical
--CHR.sub.4 R.sub.5, wherein R.sub.4 and R.sub.5, which may be identical
or different, are each a hydrogen atom, an optionally substituted
phenyl radical, or a 5- or 6-membered heterocycle; the acylated
derivatives or the physiologically acceptable salts thereof, either
singly or in any admixture in any proportion; said compound and/or
said compositions being well suited to induce and/or stimulate hair
growth and/or to prevent hair loss.
DETAILED DESCRIPTION OF BEST MODE AND SPECIFIC/PREFERRED EMBODIMENTS
OF THE INVENTION
More particularly according to the present invention, the subject
compounds exhibit marked utility as active principles for inducing
and/or stimulating hair growth and/or for preventing hair loss.
It was hitherto unknown to administer such compounds for combating
hair loss.
According to the invention, by the term "heterocycle"
is preferably intended a ring optionally including one or more nitrogen
and/or oxygen atoms, and particularly pyridine, imidazole, tetrahydrofuran
or furan. One heterocycle which is particularly preferred according
to the invention is pyridine.
By the expression "C.sub.1 -C.sub.4 alkyl radical" are
intended linear or branched acyclic radicals having from 1 to 4
carbon atoms, derived from the removal of a hydrogen atom from a
hydrocarbon molecule, and in particular methyl, ethyl, propyl, isopropyl,
butyl, isobutyl or tert-butyl radicals.
By the expression "C.sub.7 -C.sub.12 aralkyl radical"
are preferably intended alkylaryl radicals containing from 7 to
12 carbon atoms, in which definition the term "aryl" connotes
an aromatic ring containing 5 or 6 carbon atoms or an aromatic heterocycle
containing 5 or 6 atoms. According to the invention, the aralkyl
radical is preferentially C.sub.7 -C.sub.10. One aralkyl radical
which is particularly preferred according to the invention is the
benzyl radical.
And by the expression "optionally substituted phenyl radical"
is preferably intended a phenyl radical optionally substituted with
a cyano (--CN) group, a trifluoromethyl (--CF.sub.3) group, a methoxy
(--O--CH.sub.3) radical or a halogen atom. The halogen atom can
be selected from among chlorine, bromine, fluorine and iodine. One
substituted phenyl radical which is particularly preferred according
to the invention is a phenyl radical substituted with a trifluoromethyl
(--CF.sub.3) group.
In one preferred embodiment of the invention, R.sub.1 is a hydrogen
atom or a methyl or ethyl radical.
In another preferred embodiment of the invention, R.sub.2 is a
hydrogen atom or a methyl radical.
And in a very preferred embodiment of the invention, R.sub.1 and
R.sub.2 are each a hydrogen atom.
Exemplary compounds of formula (I) include: 4,6-dimethoxyindole-2-carboxylic
acid; methyl 4,6-dimethoxyindole-2-carboxylate; N-methyl-4,6-dimethoxyindole-2-carboxylic
acid; methyl N-methyl-4,6-dimethoxyindole-2-carboxylate; N-ethyl-4,6-dimethoxyindole-2-carboxylic
acid.
Among these compounds, that most particularly preferred is 4,6-dimethoxyindole-2-carboxylic
acid.
According to the invention, the subject compounds can be used alone
or as a mixture.
It will of course be appreciated that the effective amount of compound
to be administered corresponds to the amount required to elicit
the desired result. One skilled in this art is thus capable of evaluating
this effective amount, which depends on the nature of the compound
and on the person thus treated. To provide an order of magnitude,
in the compositions according to the invention the compound of formula
(I) is typically present at a concentration ranging from 0.3% to
30% by weight relative to the total weight of the composition and
preferably from 0.5% to 20%.
According to the invention, the compounds of formula (I) can be
formulated into any suitable medium (vehicle, diluent or carrier)
for cosmetic or pharmaceutical applications. The compounds of formula
(I) are preferentially formulated into compositions for cosmetic
application.
The physiologically acceptable medium in which the active agent
is formulated according to the invention is anhydrous or aqueous.
By the expression "anhydrous medium" is intended a solvent
medium containing less than 1% water. This medium is a solvent or
a mixture of solvents selected more particularly from among C.sub.2
-C.sub.4 lower alcohols such as ethyl alcohol, alkylene glycols
such as propylene glycol, and alkylene glycol alkyl ethers or dialkylene
glycol alkyl ethers, the alkyl or alkylene radicals of which have
from 1 to 6 carbon atoms. By the expression "aqueous medium"
is intended a medium of water or of a mixture of water and another
physiologically acceptable solvent, selected in particular from
among the organic solvents indicated above. In this latter instance,
when these other solvents are present, they constitute approximately
5% to 95% by weight of the composition.
The physiologically acceptable medium can also contain other adjuvants
and additives usually formulated into cosmetics or pharmaceuticals,
such as surfactants, thickeners or gelling agents, cosmetic agents,
preservatives, and acidifying and basifying agents that are well
known to the prior art, and in amounts that are sufficient to provide
the desired presentation form, in particular a more or less thickened
lotion, a gel, an ointment, a milk, an emulsion or a cream. The
composition can optionally be provided in a form pressurized as
an aerosol or vaporized from a pump-dispenser bottle.
The subject active agents can also be formulated in combination
with compounds for further improving the activity on hair growth
and/or on preventing hair loss, which have already been described
for such activity.
Among these, more particularly exemplary are: (a) nicotinic acid
esters, in particular tocopheryl nicotinate, benzyl nicotinate and
C.sub.1 -C.sub.6 alkyl nicotinates such as methyl or hexyl nicotinate;
(b) pyrimidine derivatives, such as 2,4-diamino-6-piperidinopyrimidine
3-oxide or "Minoxidil" described in U.S. Pat. Nos. 4,139,619
and 4,596,812; (c) agents for promoting hair regrowth, such as those
described in the European patent application published under No.
0,648,488 assigned to the assignee hereof; (d) antibacterial agents
such as macrolides, pyranosides and tetracyclines, and in particular
erythromycin; (e) calcium antagonists such as Cinnarizine, Diltiazem,
Nimodipine and Nifedipine; (f) hormones, such as estriol or analoges
thereof, or thyroxine and salts thereof; (g) steroidal anti-inflammatory
agents, such as corticosteroids (for example hydrocortisone); (h)
antiandrogenic agents, such as oxendolone, spironolactone, diethylstilbestrol
and flutamide; (i) steroidal or non-steroidal 5.alpha.-reductase
inhibitors such as finasteride; (j) potassium agonists such as cromakalim
and nicorandil.
Other compounds are also representative additives, for example,
diazoxide, spiroxazone, phospholipids such as lecithin, linoleic
acid, linolenic acid, salicylic acid and derivatives thereof described
in FR-2,581,542, for instance salicylic acid derivatives bearing
an alkyl radical having from 2 to 12 carbon atoms in position 5
of the benzene ring, hydroxycarboxylic or ketocarboxylic acids and
esters thereof, lactones and the corresponding salts thereof, anthralin,
carotenoids, eicosatetraenoic and eicosatrienoic acids or esters
and amides thereof, vitamin D and derivatives thereof, and extracts
of plant or bacterial origin.
The compositions comprising at least one compound of formula (I)
can also be formulated in liposomal form, as described, in particular,
in WO-94/22468, filed Oct. 13, 1994 by the company Anti-Cancer Inc.
Thus, the compound encapsulated in the liposomes can be delivered
selectively to the hair follicles.
The cosmetic compositions according to the invention can be topically
applied onto the alopecic regions of the scalp and hair of an individual,
and are optionally maintained in contact for several hours and then
optionally rinsed therefrom. For example, the compositions containing
an effective amount of at least one compound as described above
can be applied in the evening, maintained in contact throughout
the night and optionally shampooed out in the morning. These applications
can be repeated daily for one or more months depending on the particular
individual.
Thus, the present invention also features a cosmetic regime/regimen
for treating the hair and/or the scalp, comprising topically applying
onto the hair and/or the scalp a cosmetic composition which comprises
an effective amount of at least one compound of formula (I), in
maintaining this composition in contact with the hair and/or the
scalp, and optionally rinsing same therefrom.
Such regime/regimen has the characteristics of a cosmetic methodology
since it improves the aesthetics of the hair by rendering it more
vigorous and better in appearance.
In order to further illustrate the present invention and the advantages
thereof, the following specific examples are given, it being understood
that same are intended only as illustrative and in nowise limitative.
EXAMPLE 1
Comparative Evaluations of the Inhibitory Effect of 4,6-Dimethoxyindole-2-carboxylic
Acid and of 5-Methoxy-6-benzyloxyindole-2-carboxylic Acid on Type
I and Type II 5.alpha.-Reductases
The coding sequences (complementary deoxyribonucleic acids: cDNAs)
of 5.alpha.-reductase I and of 5.alpha.-reductase II were cloned
into the eukaryotic expression vector pSG5 (Stratagene). The enzymes
were overexpressed after transient transfection of COS7 cells (ATCC,
CRL 1651). The 5.alpha.-reductase I and 5.alpha.-reductase II cDNAs
were obtained by reverse transcription and polymerase chain reaction
(PCR) using specific primers from human testicle total RNA (marketed
by Clontech).
The primers (SEQ ID NOS.: 1 and 2) used to obtain the 5.alpha.-reductase
I cDNA were: +strand: 5'CCCAGCCCTGGCGATGGCAAC 3', -strand: 5'GGATATTCAACCTCCATTTCAG
3'.
The primers (SEQ ID NOS.: 3 and 4) used to obtain the 5.alpha.-reductase
II cDNA were: +strand: 5'GCGATGCAGGTTCAGTG 3', -strand: 5'ATTGTGGGAGCTCTGCT
3'.
The 5.alpha.-reductase I cDNA obtained was inserted, by standard
genetic engineering techniques, into the BamHI site of pSG5 and
the 5.alpha.-reductase II cDNA obtained was inserted into the EcoRI
site (see Maniatis et al., Molecular Cloning, Cold Spring Harbor,
1989).
The positive clones (recombinants) were identified by the technique
of hybridization with a cold probe (Plex luminescent kits, Millipore)
and mapped by enzymatic digestions and partial sequencing. After
transient transfection, the COS7 cells were lysed in a 10 mM Tris-HCl,
pH=7/150 mM KCl/1 mM EDTA buffer by 3 cycles of freezing/thawing.
The homogenate was centrifuged at 100,000.times.g for 1 hour. The
pellets containing the 5.alpha.-reductase I or 5.alpha.-reductase
II were taken up in a 40 mM, pH 6.5 phosphate buffer or 40 mM, pH
5.5 citrate buffer for 5.alpha.-reductase I or 5.alpha.-reductase
II, respectively.
5 .mu.g of proteins thus obtained were incubated in a 96-well plate
(NUNC) in the presence of 1 nM .sup.14 C-testerone (Amersham) and
5 mM nicotinamide adenosine dinucleotide phosphate, reduced form
(NADPH) (Sigma) in the corresponding buffer (40 mM, pH 6.5 phosphate
buffer or 40 mM, pH 5.5 citrate buffer for 5.alpha.-reductase I
or 5.alpha.-reductase II, respectively) for 50 minutes at 37.degree.
C. after addition of the test products. The test products were added
at concentrations from 10.sup.-4, M to 10.sup.-10 M, diluted in
40 mM, pH 6.5 phosphate buffer or 40 mM, pH 5.5 citrate buffer for
5.alpha.-reductase I or 5.alpha.-reductase II, respectively.
The reaction mixtures were then deposited directly on a silica
plate (HPTLC, 60F 254, Merck) and subjected to chromatography (solvent=10%
diethyl ether, 90% dichloromethane). They were then analyzed by
digital autoradiography (Digital Autoradiography, Berthold).
The inhibition of the activity of the isoenzymes was measured by
calculating the percentage of dihydrotestosterone formed from .sup.14
C-testosterone relative to an untreated control.
The results obtained are reported in the following Table:
TABLE Type I 5.sub..alpha. - Type II 5.sub..alpha. - reductase
reductase Compound IC.sub.50 (.mu.M) IC.sub.50 (nM) ##STR2## 1 1
##STR3## 50 >>50 (.mu.M) A: 5-methoxy-6-benzyloxyindole-2-carboxylic
acid B: 4,6-dimethoxyindole-2-carboxylic acid
4,6-Dimethoxyindole-2-carboxylic acid exhibited no inhibitory effect
on the 5.alpha.-reductases.
EXAMPLE 2
The following specific compositions according to the invention
were formulated via conventional cosmetics/pharmacy techniques.
Lotion:
4,6-Dimethoxyindole-2-carboxylic acid 5.00 g Propylene glycol 10.00
g Isopropyl alcohol qs 100.00 g
1 ml of this lotion is applied to the scalp, at a frequency of
once or twice a day.
Lotion:
4,6-Dimethoxyindole-2-carboxylic acid 1.00 g Propylene glycol 30.00
g Ethyl alcohol 40.00 g Water qs 100.00 g
This lotion is applied to the scalp once or twice a day, at a rate
of 1 ml per application.
Thickened lotion:
4,6-Dimethoxyindole-2-carboxylic acid 1.00 g Kawain 2.00 g Klucel
G .RTM.* 3.50 g Ethyl alcohol qs 100.00 g
This thickened lotion is applied to the scalp once or twice a day,
at a rate of 1 ml per application.
Lotion:
4,6-Dimethoxyindole-2-carboxylic acid 2.00 g Dowanol PM .RTM.**
20.00 g Klucel G .RTM.* 3.00 g Ethyl alcohol 40.00 g Water qs 100.00
g
This thickened lotion is applied to the scalp once or twice a day,
at a rate of 1 ml per application.
Lotion:
4,6-Dimethoxyindole-2-carboxylic acid 1.00 g Propylene glycol 30.00
g Ethyl alcohol 40.00 g Water qs 100.00 g
This lotion is applied to the scalp once or twice a day, at a rate
of 1 ml per application. *: Hydroxypropylcellulose marketed by Hercules
**: Propylene glycol monomethyl ether marketed by Dow Chemical
While the invention has been described in terms of various specific
and/or preferred embodiments, the skilled artisan will appreciate
that various modifications, substitutions, omissions, and changes
may be made without departing from the spirit thereof. Accordingly,
it is intended that the scope of the present invention be limited
solely by the scope of the following claims, including equivalents
thereof.
|